Bio 154A (Molecular Genetics)

Problem Set I (15 pts)

From the book Hannah's Heirs answer the following questions (2 pts):

1. Based upon the pedigree shown on pg. 5:

A. What is the genetic description for the transmission of AD in this family?

B. Given your answer to question 1, how do you explain individual II-9?

C. Which of the squares is Jeff?

2. What is the most unusual use of the word "diffusion" you have ever read?

3. What did Hannah die of?

4. What is Mendel's second law?

From the book Racing to the Beginning of the Road answer the following questions (2 pts):

5. Was Warbug correct?

6. What historic epidemiological study was carried out by Wynder & Evarts?

A. What ironic twist of fate befell Evarts?

B. What religious group was pivotal to the findings of this study?

7. Why is Clarence Cook Little like Darth Vader?

From Chapter 1 answer the following questions (2 pts):

8. A boy (Bb) is born with blue eyes. His father (BB) is green-eyed and his mother is blue-eyed (Bb).

A. What is the eye genotype of the father?

B. What is the eye phenotype of the father?

C. Which allele is dominant?

D. The son marries a blue-eyed woman (Bb) and they have a daughter (bb). What is the color of her eyes?

9. A boy is born with blue eyes. His father is green-eyed and his mother is green-eyed. Assume the green (B) allele is dominant to the blue (b) allele and that no mutation or recombination has taken place. Provide two explanations for this result.

10. Classify the following cells as either prokaryotes or eukaryotes: bacteria, fungi, algae, yeasts, amoebae, wheat cells, human liver cells.

From Chapter 2 answer the following questions (1.5 pts):

11. What are two major structural differences between RNA and DNA?

12. A new virus is discovered, the genome of which is found to be 29% A, 22% T, 23% C, and 26% G. What does this tell you about the genome of the virus?

13. What is the mechanistic chemical difference between the groups joined by DNA polymerase and by DNA ligase? Is there a chemical difference in the end products?

From Chapter 3 answer the following questions (1.5 pts):

14. What is a mutation and what are three common ways in which one can occur?

15. What are three types of RNA and what are each of their roles?

16. What is the amino acid sequence of the protein encoded in the following DNA molecule?

ATGCCCTTAATCTCAGCGTCCTAG

From Chapter 4 answer the following questions (3 pts):

17. List at least three differences between a prokaryotic mRNA and a eukaryotic mRNA.

18. In terms of transcription:

A. From what substrates is mRNA made?

B. On what template?

C. With what enzyme?

D. Is a primer required?

19. In prokaryotic transcription would you find a Shine-Dalgarno sequence upstream or downstream of a promoter? Upstream or downstream of the initiator AUG?

From Chapter 8 answer the following questions (1 pt):

20. In Figure 8.5, what amino acid would be generated if the intron between exons 1 and 2 was spliced out?

21. What would the phenotype of a cell be that was missing the gene encoding U1 snRNA?

From Chapter 9 answer the following questions (1 pt):

22. What are three differences between a promoter and an enhancer?

23. Almost all transcription factors are bipartite. What are the two functional domains?

From Chapter 5 answer the following questions (1 pt):

24. A KanRAmpR plasmid is treated with the BglII restriction enzyme which cleaves the amp gene. This vector is ligated to a BglII digest of human DNA and then used to transform E. coli.

A. What antibiotic-resistant phenotype(s) will be found on the plate?